View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_1D_low_55 (Length: 204)
Name: NF2258_1D_low_55
Description: NF2258_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_1D_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 37 - 187
Target Start/End: Complemental strand, 9546250 - 9546100
Alignment:
| Q |
37 |
ctgaaaccgttgaagaaggtacgaggaagatacaaatgcgacacgtgtaacaaagtgtttcgttcatatcaagcactaggtggacacagagcgagtcaca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546250 |
ctgaaaccgttgaagaaggtacgaggaagatacaaatgcgacacgtgtaacaaagtgtttcgttcatatcaagcactaggtggacacagagcgagtcaca |
9546151 |
T |
|
| Q |
137 |
agaaaaataaacaagttgcagaaagtggtggtgattattcaatttcacaac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546150 |
agaaaaataaacaagttgcagaaagtggtggtgattattcaatttcacaac |
9546100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University