View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_2D_low_13 (Length: 264)
Name: NF2258_2D_low_13
Description: NF2258_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_2D_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 85 - 248
Target Start/End: Original strand, 9086894 - 9087057
Alignment:
| Q |
85 |
agctgtaacttcttatggagcacaagcattagattgcattagtcatatacaatagaataggatgatgatcagacttagactttgttaacctgcaatatgt |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086894 |
agctgtaacttcttatgaagcacaagcataagattgcattagtcatatacaatagaataggatgatgatcagacttagactttgttaacctgcaatatgt |
9086993 |
T |
 |
| Q |
185 |
aacattattccaaccttccatggctcagccgaaaaataaattttggtttataatagacacacag |
248 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086994 |
aaaattattccaaccttccatggctcagccgaaaaataaattttggtttataatagacacacag |
9087057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 9086827 - 9086740
Alignment:
| Q |
1 |
ttgattgtgtttaggagctcattgataaatttggcgaaaatgagcggttaatgcacatagtatagctcatgatttgttacaacaagct |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9086827 |
ttgattgtgtttaggagctcattgataaatttggcgaaaatgagcggttaatgcacatagtatagctcatgatttgttacaacaagct |
9086740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University