View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_2D_low_15 (Length: 261)
Name: NF2258_2D_low_15
Description: NF2258_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_2D_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 49008834 - 49009069
Alignment:
| Q |
7 |
ttggtgtttaaggagaaaaatgaaaaggtggcatacaagttgaggatagaaggtcccaaaatggaggaaaataaagtagtttttgggtatctcacttgga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49008834 |
ttggtgtttaaggagaaaaatgaaaaggtggcatacaagttgaggatagaaggtcccaaaatggaggaaaataaagtagtttttgggtatctcacttgga |
49008933 |
T |
 |
| Q |
107 |
cagactcgaaacacaatgtcagaagtcccattgttgtgactagcctcaactcagaattaacacccccatagagcttaaagtgtttccttgaatattaatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49008934 |
cagactcgaaacacaatgtcagaagtcccattgttgtgactagcctcaactcagaattaacacccccatagagcttaaagtgtttccttgaatattaatg |
49009033 |
T |
 |
| Q |
207 |
attgcttaggttaagatgaggatattatgcttctac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49009034 |
attgcttaggttaagatgaggatattatgcttctac |
49009069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University