View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_2D_low_21 (Length: 240)
Name: NF2258_2D_low_21
Description: NF2258_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_2D_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 45716041 - 45715829
Alignment:
| Q |
18 |
ctcacctctctcaccttactcaaccttgaagataatcagttttccggtgaactccccggtgagcttggggggttgtttcagctagaaactctaagcctcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45716041 |
ctcacctctctcaccttactcaaccttgaagataatcagttttccggtgaactccccggtgagcttggtgggttgtttcagctagaaactctaagcctcg |
45715942 |
T |
|
| Q |
118 |
gttcaaactctttcgccggaaaaattccaccggagtttggttttttaactaaactacgtacacttgatctttccggtaatgcactcgccggagatatacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45715941 |
gttcaaactctttcgccggaaaaattccaccggattttggttttttaaataaactacgtacacttgatctttccggtaatgcactcgccggagatatacc |
45715842 |
T |
|
| Q |
218 |
ggagtgttttgga |
230 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
45715841 |
ggagagttttgga |
45715829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University