View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_high_13 (Length: 329)
Name: NF2258_high_13
Description: NF2258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 17 - 319
Target Start/End: Original strand, 44453020 - 44453322
Alignment:
| Q |
17 |
tatataacttcaatctctttgcaggtggaattcttgctcactaacttatgtgatacggcatcaattggagagctagaattaaaagtaagctatcatgctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44453020 |
tatataacttcaatctctttgcaggtggaattcttgctcactaacttatgtgatacggcatcaattggagagctagaattaaaagtaagctatcatgctg |
44453119 |
T |
|
| Q |
117 |
atcaatgaatttattctcttcataagcacaatatttttcacgtactctattaaatcttgcttcctttgttgtttcttcttcattaccatctgcctaacct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44453120 |
atcaatgaatttattctcttcataagcacaatatttttcacgtactctattaaatcttgcttcctttgttgtttcttcttcattaccatctgcctaacct |
44453219 |
T |
|
| Q |
217 |
ccaaatatatatcagcttgatggatttcacctgcgtgtagtgagggatttgactgaaaaatctaaaacacttcctccttcaattcctgctcctgtaagta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44453220 |
ccaaatatatatcagcttgatggatttcacctgcgtgtagtgagggatttgactgaaaaatctaaaacacttcctccttcaattcctgctcctgtaagta |
44453319 |
T |
|
| Q |
317 |
taa |
319 |
Q |
| |
|
||| |
|
|
| T |
44453320 |
taa |
44453322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University