View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_high_27 (Length: 244)
Name: NF2258_high_27
Description: NF2258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 2246641 - 2246415
Alignment:
| Q |
1 |
ggtcaacgaggattagttttagtgaagtaaacctggataaaaaatgtttaagtagatcatattttatttctttcaaaatacatatcataagagatatttn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2246641 |
ggtcaacgaggattagttttagtgaagtaaacctggttaaaaaatgtttaagtagatcatattttatttctttcaaaatacatatcataagagatattta |
2246542 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnnn-gtacaagctttttcatgtgtgtaacacttcatagtttctgatgcaggaagtaattttctcaatgtttcactaccaagatgttac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2246541 |
aaaaaaaaaaaaaaaagtacaagctttttcatgtgtgtaacacttcatagttttttatgcaggaagtaattttctcaatgtttcactgccaagatgttac |
2246442 |
T |
|
| Q |
200 |
cctatgaaggaaagacatgtgaaagtt |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2246441 |
cctatgaaggaaagacatgtgaaagtt |
2246415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University