View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2258_low_33 (Length: 229)
Name: NF2258_low_33
Description: NF2258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2258_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 35 - 213
Target Start/End: Original strand, 41863971 - 41864146
Alignment:
| Q |
35 |
atcatgctgctaccggcactacctttgctactggcaccaccactgctgtgaaatgccaaggaagaaataggagggagcacaagagaaacaacatgttcca |
134 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||| ||| |||||| || || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863971 |
atcacgctgctactggcaccacctttgctactagcaacaccacggc---gacatgccaaggaagaaataggagggagcacaagagaaacaacatgttcca |
41864067 |
T |
|
| Q |
135 |
gaggatgaaggatggcgtatccggtcacaacagtgacagtggcagtagcagtgatgagagtgacagcgacaatgaaaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864068 |
gaggatgaaggatggcgtatccggtcacaacagtgacagtggcagtagcagtgatgagagtgacagcgacaatgaaaat |
41864146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University