View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2259_high_12 (Length: 205)
Name: NF2259_high_12
Description: NF2259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2259_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 127 - 188
Target Start/End: Complemental strand, 2372404 - 2372343
Alignment:
| Q |
127 |
aaataaaaagatattatgttgaattgaccataattatttattttctttaggaccaacattat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2372404 |
aaataaaaagatattatgttgaattgaccataattatttattttctttacgaccaacattat |
2372343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 2372519 - 2372474
Alignment:
| Q |
11 |
gagatgaaatcaaagtaagagagggggatccacttttaagtgttcg |
56 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2372519 |
gagaagaaatcaaaataagagagggggatccacttttaagtgttcg |
2372474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 102
Target Start/End: Complemental strand, 2372456 - 2372428
Alignment:
| Q |
74 |
ctagattgaagatggggataaagatgatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2372456 |
ctagattgaagatggggataaagatgatg |
2372428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University