View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2259_high_3 (Length: 377)
Name: NF2259_high_3
Description: NF2259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2259_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 117 - 361
Target Start/End: Complemental strand, 6739132 - 6738888
Alignment:
| Q |
117 |
acacacaatattactgaactaagataggattcacaacaatttctgttccatactcacttaagttttatttaatcctcgggacttttttcacagcatttca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739132 |
acacacaatattactgaactaagataggattcacaacaatttctgttccacactcacttaagttttatttaatcctcgggacttttttcacagcatttca |
6739033 |
T |
 |
| Q |
217 |
gtggtaaaaattgggtgtcatctttgttcggaagttaccaatatttatacccaaaaattaggttaaagtaggaggaagaggccaaaagatgcttggctgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739032 |
gtggtaaaaattgggtgtcatctttgttcggaagttaccaatatttatacccaaaaattaggttaaagtaggaggaagaggccaaaagatgcttggctgg |
6738933 |
T |
 |
| Q |
317 |
agatggtgcaaagttggtggtttgcgcagtgtcacagaaatgcat |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6738932 |
agatggtgcaaagttggtggtttgcgcagtgtcacagaaatgcat |
6738888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 257 - 308
Target Start/End: Complemental strand, 38512906 - 38512855
Alignment:
| Q |
257 |
atatttatacccaaaaattaggttaaagtaggaggaagaggccaaaagatgc |
308 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38512906 |
atatttatactaaaaaaataggttaaagtaggaggaagaggccaaaagatgc |
38512855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University