View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2259_low_13 (Length: 207)
Name: NF2259_low_13
Description: NF2259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2259_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 70 - 185
Target Start/End: Complemental strand, 50532780 - 50532664
Alignment:
| Q |
70 |
ttaccttcatttaatatatgatattcttcaaatacgattacttctaacggaagaaatttatatatnnnnnnnnggggaagagtggataaatcacgttttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
50532780 |
ttaccttcatttaatatatgatattcttcaaatacgattacttccgacggaagaaatttatatataaaaaaaagggtaagagtggataaatcacgttttt |
50532681 |
T |
|
| Q |
170 |
a-gccctatacgttaat |
185 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
50532680 |
aggccctatacgttaat |
50532664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University