View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_high_25 (Length: 264)
Name: NF2261_high_25
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 16772331 - 16772583
Alignment:
| Q |
1 |
ttctttggtggggacaatatacttttagtaggtggcataatgattttctcatcaccagcatcatcatgacgtcggcgctttaggtcataggtatttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16772331 |
ttctttggtggggacaatatacttttagtaggtgacataatgattttctcatcaccagcatcatcatgacgtcggcgctttaggtcataggtatttttgt |
16772430 |
T |
 |
| Q |
101 |
ttgttttctttatttggtcagcttttggcctaggtggcatgtcactatgtgatggatcggttttggatttttgggccatgctagacaagatattaaacct |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16772431 |
ttgttttctttatttggtcaccttttggcctaggtggcatgtcactatgtggtggatcggttttggatttttgggccatgctagacaagatattaaacct |
16772530 |
T |
 |
| Q |
201 |
atttttattagtggtggtttttgatgttggtggggtagggttgttcacaggtt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16772531 |
atttttattagtggtggtttttgatgttggtggggtagggttgttcacaggtt |
16772583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University