View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_high_35 (Length: 226)
Name: NF2261_high_35
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_high_35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 36 - 226
Target Start/End: Complemental strand, 38214116 - 38213926
Alignment:
| Q |
36 |
ttggttcattatgtaccacaattcatttcgacagtagtgtactctcgtaaaacactggatgtggatagttggtcgactattaagtaaaaaggttgcgtgt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38214116 |
ttggttcattatgtaccacaattcatttcgacagtagtatactctcgtaaaacactggatgtggatagttggtcgactattaagtaaaaaggttgggtgt |
38214017 |
T |
 |
| Q |
136 |
gtataaatgattcaattgannnnnnnacaaagattgtattgagtattgatccttgatggtaaatttttaagaatcatcatatatgttataa |
226 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38214016 |
gtataaatgattcaattgatttttttaaaaagattgtattgagtattgatccttgatggcaaatttttaagaatcatcatatatgttataa |
38213926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University