View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_high_6 (Length: 486)
Name: NF2261_high_6
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 61 - 440
Target Start/End: Original strand, 35915907 - 35916286
Alignment:
| Q |
61 |
tattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915907 |
tattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggt |
35916006 |
T |
 |
| Q |
161 |
cagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916007 |
cagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcat |
35916106 |
T |
 |
| Q |
261 |
cccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaaca |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916107 |
cccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaaca |
35916206 |
T |
 |
| Q |
361 |
atcannnnnnngccttaatcctttggttcacacgggaataagactgcgataattcagaattcggtcaggagttcttaccg |
440 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916207 |
atcatttttttgccttaatcctttggttctcacgggaataagactgcgataattcagaattcggtcaggagttcttaccg |
35916286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University