View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_low_19 (Length: 343)
Name: NF2261_low_19
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 94 - 326
Target Start/End: Complemental strand, 7107630 - 7107381
Alignment:
| Q |
94 |
tattaatttatacattaactcttttgtttgaatgcattacatattcctcctcagactagtgcagatttctttaataagaggctt---------------- |
177 |
Q |
| |
|
||||||||||| ||||||||||||| | ||||||||| |||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7107630 |
tattaatttatccattaactcttttatctgaatgcatgacat--tcctcctcagactagtgcaaatttctttaataagaggcttgatttaccatgtttta |
7107533 |
T |
|
| Q |
178 |
---ttgtaaatggttcaaacgttttggcttactccccctttccnnnnnnnatatctatttttggtttacatgtctgatgctctttgcatcatcagtttat |
274 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7107532 |
gatttgtaaatggttgaaaggttttggcttagtcccccttccctttttgtatacctatttttggtttacatgtctgatgctctttgcatcatcagtttat |
7107433 |
T |
|
| Q |
275 |
taaataaattaccaccaacatgaataacattattttagctctatgagacatt |
326 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
7107432 |
taaataaattaccagcaacaagaataacattattttagctctatgaaacatt |
7107381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 7107904 - 7107840
Alignment:
| Q |
5 |
ctgcttaggcttaaccagtaacatgaacttcatagtttctcatatctgtagggaatgaaattgtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7107904 |
ctgcttaggcttaaccagtaacatgaacttcatagtttctcatatctgtagggaatgaaattgtt |
7107840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University