View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_low_23 (Length: 324)
Name: NF2261_low_23
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 35916258 - 35916562
Alignment:
| Q |
1 |
attcagaattcggtcagtagttcttaccgataatatatatatacctattgtttataatctcaatgtgtttgtcttatacattattggcaaaaaattatac |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916258 |
attcagaattcggtcaggagttcttaccgataatat--atatacctattttttaacatctcaatgtgtttgtcttatacattattggcaaaaaattatac |
35916355 |
T |
 |
| Q |
101 |
aaattaatagattaaatgcatgtatagttttgctgacgaggttgcgggtttgcatctttgtgcaatgtaggggatgatcctgaattggtgaagaccaagt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35916356 |
aaattaatatattaaatgcatgtatagttttgctgacgaggttgcgggtttgcatctttgtgcaatgtaggggatgatcctgaattggtgaagaccaaat |
35916455 |
T |
 |
| Q |
201 |
taagacattgggctcaagctgttgcatgttccgtgatgcagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916456 |
taagacattgggctcaagctgttgcatgttccgtgatgcagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaaga |
35916555 |
T |
 |
| Q |
301 |
tgcacat |
307 |
Q |
| |
|
||||||| |
|
|
| T |
35916556 |
tgcacat |
35916562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University