View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_low_31 (Length: 249)
Name: NF2261_low_31
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 241
Target Start/End: Complemental strand, 153190 - 152952
Alignment:
| Q |
3 |
atatctcaattatacttatattcaacacaaacacaacaaacgtttattaaaatattagcacaactctgcaaaagtcgtatcaaaaccgacaatcgcaatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
153190 |
atatctcaattatacttatattcaacacaaacacaacaaaagtttattaaaatattaacacaattctgcaaaagtcgtatcaaaaccgacaatcgcaatt |
153091 |
T |
|
| Q |
103 |
caaaaaacactttgaaagctgtaagccatgaagctatgcacaaaataaaacatcttccattgttacactatttttaatttacaaaaccctcccatttttt |
202 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153090 |
caataaacactttgaaagctgtaagccatgaagctatgcacaaaataaaacatcttccattgttacactatttttaatttacaaaaccctcccatttttt |
152991 |
T |
|
| Q |
203 |
gttagaaaacgtgatagttagagaatttgccccctatgc |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
152990 |
gttataaaacgtgatagttagagaatttgccccccatgc |
152952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University