View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_low_40 (Length: 225)
Name: NF2261_low_40
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_low_40 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 225
Target Start/End: Original strand, 38213717 - 38213934
Alignment:
| Q |
8 |
ctttaataatttgattacagtagagatatatggtgaacttttttagaggatcaccttcataaaaggaaccatgaggtgattagattggtttcattgtact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213717 |
ctttaataatttgattacagtagagatatatggtgaacttttttagaggatcaccttcataaaaggaaccatgaggtgattagattggtttcattgtact |
38213816 |
T |
|
| Q |
108 |
ctttgttggatagaaatatagtctataatatttaaggatggttgcctttcatgctagaatgttaatcggaaagttaataatttagatttagtgattgaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38213817 |
ctttgttggatagaaatatagtctataatatttaaggatggttgcctttcatgctagaatgttaatcggaaagttaataatttagatttagtgattgaat |
38213916 |
T |
|
| Q |
208 |
tgacaacttttataacat |
225 |
Q |
| |
|
| | |||||||||||||| |
|
|
| T |
38213917 |
taataacttttataacat |
38213934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University