View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2261_low_42 (Length: 207)
Name: NF2261_low_42
Description: NF2261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2261_low_42 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 16772249 - 16772043
Alignment:
| Q |
1 |
aacaaaaaataatttggccccaccacacataagccaaccgaaccaaaataaccccaaccaaagcactaattacaaaactgtcacttctcatacaagtacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16772249 |
aacaaaaaataatttggccccaccacacataagccaaccgaaccaaaataaccccaaccaaagcactaattacaaaactgccacttctcatacaagtacc |
16772150 |
T |
 |
| Q |
101 |
ttccaaacccatgagaataacagtaacaataataactagctcattcttgaggaattggatgatgatacaatgattggtcaggccaccacagagacaatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16772149 |
ttccaaacccatgagaataacagtaacagtaataacgagctcattcttgagcaattggatgatgatacaatgattggtcaggccaccacagagacaatcc |
16772050 |
T |
 |
| Q |
201 |
aagtgaa |
207 |
Q |
| |
|
||||||| |
|
|
| T |
16772049 |
aagtgaa |
16772043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University