View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2262-Insertion-8 (Length: 125)

Name: NF2262-Insertion-8
Description: NF2262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2262-Insertion-8
NF2262-Insertion-8
[»] chr2 (1 HSPs)
chr2 (8-125)||(13447632-13447749)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 13447749 - 13447632
Alignment:
8 ttttcaactgcgagagtgtttatgtcaacacttctgtcagtctgacattgctgttgtttacagtcgaatgaaatggaagaatcctgtaaagctggtttct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||    
13447749 ttttcaactgcgagagtgtttatgtcaacacttctgtcagtctgacattgccgttgtttacagtcgaatgaaatggaagaatcctgtaaagctggttcct 13447650  T
108 gtactttaaatctctaga 125  Q
    ||||||||||||||||||    
13447649 gtactttaaatctctaga 13447632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University