View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2262-Insertion-8 (Length: 125)
Name: NF2262-Insertion-8
Description: NF2262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2262-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 13447749 - 13447632
Alignment:
| Q |
8 |
ttttcaactgcgagagtgtttatgtcaacacttctgtcagtctgacattgctgttgtttacagtcgaatgaaatggaagaatcctgtaaagctggtttct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13447749 |
ttttcaactgcgagagtgtttatgtcaacacttctgtcagtctgacattgccgttgtttacagtcgaatgaaatggaagaatcctgtaaagctggttcct |
13447650 |
T |
|
| Q |
108 |
gtactttaaatctctaga |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13447649 |
gtactttaaatctctaga |
13447632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University