View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2262R-Insertion-1 (Length: 125)
Name: NF2262R-Insertion-1
Description: NF2262R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2262R-Insertion-1 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 9 - 125
Target Start/End: Complemental strand, 15757452 - 15757337
Alignment:
| Q |
9 |
ataaatgaaattgttaactcaatatatgagaaatctaatacgaacccacaattttaacacaaagaaagagagaaaaaatacccttccggaagcagaatac |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15757452 |
ataaacgaaattgttaactcaatatatgagaaatctaatacgaacccacaattttaacacaaagaaagagaga-aaaatacccttccagaagcagaatac |
15757354 |
T |
 |
| Q |
109 |
aacagctaataagatac |
125 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
15757353 |
agcagctaataagatac |
15757337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University