View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2262R-Insertion-2 (Length: 165)
Name: NF2262R-Insertion-2
Description: NF2262R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2262R-Insertion-2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 46 - 165
Target Start/End: Complemental strand, 38864652 - 38864533
Alignment:
| Q |
46 |
cagctctgaaaccttttatacctacacaagcgtcgtgttgtcttaaaccagaaaactactgttcaattaaataactctgtttaactttttgaattttgag |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38864652 |
cagctctgaaaccttttatacctacacaagcgtcgtgttgtcttaaaccagaaaactactgttcaattaaataactctgtttaactttttgaattttgag |
38864553 |
T |
|
| Q |
146 |
ccttataattatggtactgc |
165 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38864552 |
ccttataattatggtactgc |
38864533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University