View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2262R-Insertion-4 (Length: 255)
Name: NF2262R-Insertion-4
Description: NF2262R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2262R-Insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 31828896 - 31828653
Alignment:
| Q |
9 |
atatttgtggttagttccggcctgcaaatcggtttccacggcaaaaataccaaacaaacggttagcacatccacacatatactagaaaataaaaatttga |
108 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828896 |
atatttgtggttagctccggcctgcaaatcggtttccactacaaaaataccaaacaaacggttagcacatccacacatatactagaaaataaaaatttga |
31828797 |
T |
|
| Q |
109 |
atttgtcacaaatatttgagacaaaaaatatataaattgtatctagttggagcgattcgggttcaccgaccaccgtcttcgatggtggactaattctagt |
208 |
Q |
| |
|
||| |||| ||| ||| |||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31828796 |
attggtcaaaaaaattccagacaaaa--tatataaattgtatctagttgaagcgattcaggttcaccgaccaccgtcttcgatggtggattaattctagt |
31828699 |
T |
|
| Q |
209 |
catttttggacaaaactggtttggccggatttgaacccgagttcat |
254 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
31828698 |
catttttggacaaaactgatttggccggattcgaacccgagttcat |
31828653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University