View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2262_low_10 (Length: 355)
Name: NF2262_low_10
Description: NF2262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2262_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 146 - 350
Target Start/End: Complemental strand, 33216830 - 33216626
Alignment:
| Q |
146 |
tactttgcagctgaaccagatatctgagacttcttcttctcattcaaaggatttgtttgatctttcgcaacagaaccttgttggttggaacttcttctca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33216830 |
tactttgcagctgaaccagatatctgagacttcttcttctcgttcaaaggatttgtttgatctttcgcaacagaaccttgttggttggaactttttctca |
33216731 |
T |
 |
| Q |
246 |
tatcaatggcatctgaaaaacctctttttgcacctgaaaataaactattaagcatgcataaagagtatgcannnnnnncttcaagaagatcattatctct |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33216730 |
tatcaatggcatctgaaaaacctctttttgcacctgaaaataaactattaagcatgcataaagagtatgcatttttttcttcaagaagatcattatctct |
33216631 |
T |
 |
| Q |
346 |
ctctg |
350 |
Q |
| |
|
||||| |
|
|
| T |
33216630 |
ctctg |
33216626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 74
Target Start/End: Complemental strand, 33216956 - 33216902
Alignment:
| Q |
20 |
ataaggacttatatgataattgcttatactatatccaaacaaagcctaaaagttt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33216956 |
ataaggacttatatgataattgcttatactatatccaaacaaagcctaaaagttt |
33216902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University