View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2262_low_18 (Length: 249)
Name: NF2262_low_18
Description: NF2262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2262_low_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 39015054 - 39014822
Alignment:
| Q |
17 |
taccaaaccatccctagtggctataacaaacttgattctttttcttcccccatgacaacacttcatcatttaaatccaaaccaaaacaattcttccatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39015054 |
taccaaaccatccctagtggctataacaaacttgattctttttcttcccccatgacaacacttcatcatttaaatccaaaccaaaacaattcttccatga |
39014955 |
T |
|
| Q |
117 |
tgaatctccttcaatattcacgtgaaacaaatccaaatgataatagcacggttactcaaattagttccaaaggtgatgatggatatggatttttgtggaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39014954 |
tgaatctccttcaatattcacgtgaaacaaatccaaatgataatagcacggttactcaaattagttccaaaggtgatgatggatatggattcttgtggaa |
39014855 |
T |
|
| Q |
217 |
catggatttggaagaaaatagtctagaagatgg |
249 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
39014854 |
catggatttggaagaaaatagcctagaagatgg |
39014822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 30484160 - 30484224
Alignment:
| Q |
167 |
gttactcaaattagttccaaaggtgatgatggatatggatttttgtggaacatggatttggaaga |
231 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
30484160 |
gttactcaaattagtcctaaatgtgatgatggatatggatatttgtgggacatggatttggaaga |
30484224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University