View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2262_low_9 (Length: 371)

Name: NF2262_low_9
Description: NF2262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2262_low_9
NF2262_low_9
[»] chr1 (1 HSPs)
chr1 (312-357)||(42090152-42090197)


Alignment Details
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 312 - 357
Target Start/End: Complemental strand, 42090197 - 42090152
Alignment:
312 tgaataagtgttgcgatggttgagggtgttaaattgcgttgttatt 357  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
42090197 tgaataagtgttgcgatggttgagggtgttaaattgcgttgttatt 42090152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University