View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2264_low_13 (Length: 293)
Name: NF2264_low_13
Description: NF2264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2264_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 56311937 - 56312079
Alignment:
| Q |
5 |
gttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttcaacgttgagcttatta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311937 |
gttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttcaacgttgagcttatta |
56312036 |
T |
|
| Q |
105 |
cttttctcgatctttatcgctatgacccttgggaacttcctgg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312037 |
cttttctcgatctttatcgctatgacccttgggaacttcctgg |
56312079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 194 - 293
Target Start/End: Original strand, 56312123 - 56312220
Alignment:
| Q |
194 |
gagaacttcccctttcctaaagcaattctggaaaccc--ttttttgttgccatccctctttgatttaaataatataataataatccttcttattggctag |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
56312123 |
gagaacttcccctttcctaaagcaattctggaaacccttttttttgttgccatccctctttgattt-aataatataataata---cttcttattggctag |
56312218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 48
Target Start/End: Original strand, 8449724 - 8449761
Alignment:
| Q |
11 |
ccagggtttcgtttccatccaactgaagaagaacttgt |
48 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
8449724 |
ccagggtttcgtttccacccaactgatgaagaacttgt |
8449761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University