View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2264_low_19 (Length: 246)
Name: NF2264_low_19
Description: NF2264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2264_low_19 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 39266096 - 39266040
Alignment:
| Q |
190 |
atgttgcgagtttgatgctttataattgttggaagagatgaatttagtgttatgaac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39266096 |
atgttgcgagtttgatgctttataattgttggaagagatgaatttagtgttatgaac |
39266040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 39 - 84
Target Start/End: Complemental strand, 39266172 - 39266128
Alignment:
| Q |
39 |
gtttttaatgtttgtgagatttgattttgagatcattttggtttga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39266172 |
gtttttaatgtttgtgagatttgattttga-atcattttggtttga |
39266128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 39266235 - 39266203
Alignment:
| Q |
11 |
cagagatggtaaaatcactattgaatgagtttt |
43 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
39266235 |
cagagatggtaaaatcactattgattgagtttt |
39266203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 117
Target Start/End: Complemental strand, 49156159 - 49156080
Alignment:
| Q |
37 |
gagtttttaatgtttgtgagatttgattttgagatcattttggtttgaatctttatgttacgtttcatggatctggatgtg |
117 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||| ||||||||| |||| ||| |||||||||||||| |||||| |
|
|
| T |
49156159 |
gagtttttactgtttgtgagatctgattttgaaatcattgcggtttgaat-tttaagttgcgtttcatggatctagatgtg |
49156080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 244
Target Start/End: Complemental strand, 49155986 - 49155939
Alignment:
| Q |
197 |
gagtttgatgctttataattgttggaagagatgaatttagtgttatga |
244 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
49155986 |
gagtttgatgctttataattattggaagaaatggatttagtgttatga |
49155939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University