View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2267_low_10 (Length: 238)

Name: NF2267_low_10
Description: NF2267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2267_low_10
NF2267_low_10
[»] chr3 (2 HSPs)
chr3 (17-238)||(249685-249907)
chr3 (189-238)||(249994-250044)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 249685 - 249907
Alignment:
17 attatgtggaagcaagatcatatgaagttagctagggtaaaagcaaatattatcttcaatttgtaaatgattaaaataattgagagcaagatctaagaaa 116  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||    
249685 attatgtggaagcaagagcatatgaagttagctagggtaaaagcaaatataatcttcaatttgtaaatgatgaaaataattgagagcaagatctaagaaa 249784  T
117 ataaacatgatccatgaaggatatcatactgatctttttgtttgtatgtttctgtg-nnnnnnnngaagaaaattaaacaataaaattcatctcttttct 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||    
249785 ataaacatgatccatgaaggatatcatactgatctttttgtttgtatgtttctgtgtgtttttttgaagaaaattaaacaataaaattcatctcttttct 249884  T
216 ctttagactagaaaccctcatct 238  Q
    |||||||||||||||||||||||    
249885 ctttagactagaaaccctcatct 249907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 238
Target Start/End: Original strand, 249994 - 250044
Alignment:
189 ttaaacaataaaattcatctcttttctcttta-gactagaaaccctcatct 238  Q
    |||||||| ||||||||||||||||||||||| ||| ||||| ||||||||    
249994 ttaaacaacaaaattcatctcttttctctttaggaccagaaatcctcatct 250044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University