View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2267_low_10 (Length: 238)
Name: NF2267_low_10
Description: NF2267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2267_low_10 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 249685 - 249907
Alignment:
| Q |
17 |
attatgtggaagcaagatcatatgaagttagctagggtaaaagcaaatattatcttcaatttgtaaatgattaaaataattgagagcaagatctaagaaa |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
249685 |
attatgtggaagcaagagcatatgaagttagctagggtaaaagcaaatataatcttcaatttgtaaatgatgaaaataattgagagcaagatctaagaaa |
249784 |
T |
 |
| Q |
117 |
ataaacatgatccatgaaggatatcatactgatctttttgtttgtatgtttctgtg-nnnnnnnngaagaaaattaaacaataaaattcatctcttttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
249785 |
ataaacatgatccatgaaggatatcatactgatctttttgtttgtatgtttctgtgtgtttttttgaagaaaattaaacaataaaattcatctcttttct |
249884 |
T |
 |
| Q |
216 |
ctttagactagaaaccctcatct |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
249885 |
ctttagactagaaaccctcatct |
249907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 238
Target Start/End: Original strand, 249994 - 250044
Alignment:
| Q |
189 |
ttaaacaataaaattcatctcttttctcttta-gactagaaaccctcatct |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
249994 |
ttaaacaacaaaattcatctcttttctctttaggaccagaaatcctcatct |
250044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University