View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2268_high_4 (Length: 369)
Name: NF2268_high_4
Description: NF2268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2268_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 47615987 - 47616236
Alignment:
| Q |
20 |
ccaataacccgttatagcatgccaaacataaacaaatttcacaccatgcttttcctttgcaatattcacaatactctttatccctacttctggattttcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47615987 |
ccaataacccgttatagcatgccaaacataaacaaatttcacaccatgcttttcctttgcaatattcacaatactctttatccctacttctggattttcc |
47616086 |
T |
|
| Q |
120 |
ttgttctgaaatttaggattttcttttatatcagttaacctctgcaacgatgaagaatcctccaaatcaccggcgacagattgccatccgtcgtcgatga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47616087 |
ttgttctgaaatttaggattttcttttatatcagttaacctctgcaacgatgaagaatcctccaaatcaccggcgacagattgccatccatcgtcgatga |
47616186 |
T |
|
| Q |
220 |
taacaaattttggcggagttccgccagcagaaggggactgtaaaccatcc |
269 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
47616187 |
taacaaattttggcggcgttccgccaccagaaagggactgtaaaccatcc |
47616236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 264 - 366
Target Start/End: Original strand, 47616652 - 47616755
Alignment:
| Q |
264 |
ccatccaccatagcttgaaacggaaacatgccatgaatctaacatctgttaattttcc-gagtgaaactatgtgtctgctatctgaattatccatctctg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47616652 |
ccatccaccatagcttgaaacggaaacatgccatgaatctaacatctgttaattttccagagtgaaactatgtgtctgctatctgaattatccatttctg |
47616751 |
T |
|
| Q |
363 |
ctcc |
366 |
Q |
| |
|
|||| |
|
|
| T |
47616752 |
ctcc |
47616755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University