View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2269_high_20 (Length: 236)
Name: NF2269_high_20
Description: NF2269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2269_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43906893 - 43906669
Alignment:
| Q |
1 |
ctatattgtatgtattatta---aggttaacaatgg-acgctataattttggagtccaccattgttaacagtgtgattttttcctatttgagctaaaagc |
96 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906893 |
ctatattgtatgtattattattaaggttaacaatgggacgctataattttgttgtctaacattgttaacagtgtgattttttcctatttgagctaaaagc |
43906794 |
T |
|
| Q |
97 |
aaaaaagaaatagaccaaaaccaagccacacgcataggtagacaaacacaaacttcactttctataaaggaattgcatgacattcttgtagaacaagttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906793 |
aaaaaagaaatagaccaaaaccaagccacacgcataggtagacaaacacaaacttcactttctataaaggaattgcatgacattcttgtagaacaagttg |
43906694 |
T |
|
| Q |
197 |
aaacatgacaaggttttgtttttga |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43906693 |
aaacatgacaaggttttgtttttga |
43906669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University