View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2269_low_21 (Length: 247)
Name: NF2269_low_21
Description: NF2269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2269_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 197
Target Start/End: Complemental strand, 26609441 - 26609248
Alignment:
| Q |
4 |
gagtgagatgaaattgaatggaatgaaatggaacctactcacattatatattgtttggatttttgactaatggattatggaacaccattcacattccatt |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609441 |
gagtgaaatgaaattgaatggaatgaaatggaacctactcacattatatattgtttggatttttgactaatggattatggaacaccattcacattccatt |
26609342 |
T |
|
| Q |
104 |
gtttggctagtagacaaaatagaatgcattataatttttattcaatttttacgtttatattttaaaaacatcatgcacaaataaattatttggt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609341 |
gtttggctagtagacaaaatagaatgcattataatttttattcaatttttacgtttatattttaaaaacatcatgcacaaataaattatttggt |
26609248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University