View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2270_high_25 (Length: 252)

Name: NF2270_high_25
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2270_high_25
NF2270_high_25
[»] chr4 (1 HSPs)
chr4 (19-236)||(51241182-51241399)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 51241399 - 51241182
Alignment:
19 cacgtgaccctcatcatgaaaaccagaccccatagacattctcactctccgaggaaccacgccatgagaacgggtgtgggtcccaacgccaaagatgtag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51241399 cacgtgaccctcatcatgaaaaccagaccccatagacattctcactctccgaggaaccacgccatgagaacgggtgtgggtcccaacgccaaagatgtag 51241300  T
119 gttgtatgacggagaacggtgccggaaacctccatgacgatgacggtgatagtcgtcgatgaaattgaaacaaaacttcaaatttaaagtattgtttcct 218  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51241299 tttgtatgacggagaacggtgccggaaacctccatgacgatgacggtgatagtcgtcgatgaaattgaaacaaaacttcaaatttaaagtattgtttcct 51241200  T
219 ttttcggtggatgttgtg 236  Q
    ||||||||||||||||||    
51241199 ttttcggtggatgttgtg 51241182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University