View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2270_high_25 (Length: 252)
Name: NF2270_high_25
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2270_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 51241399 - 51241182
Alignment:
| Q |
19 |
cacgtgaccctcatcatgaaaaccagaccccatagacattctcactctccgaggaaccacgccatgagaacgggtgtgggtcccaacgccaaagatgtag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51241399 |
cacgtgaccctcatcatgaaaaccagaccccatagacattctcactctccgaggaaccacgccatgagaacgggtgtgggtcccaacgccaaagatgtag |
51241300 |
T |
 |
| Q |
119 |
gttgtatgacggagaacggtgccggaaacctccatgacgatgacggtgatagtcgtcgatgaaattgaaacaaaacttcaaatttaaagtattgtttcct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51241299 |
tttgtatgacggagaacggtgccggaaacctccatgacgatgacggtgatagtcgtcgatgaaattgaaacaaaacttcaaatttaaagtattgtttcct |
51241200 |
T |
 |
| Q |
219 |
ttttcggtggatgttgtg |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51241199 |
ttttcggtggatgttgtg |
51241182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University