View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2270_high_27 (Length: 250)
Name: NF2270_high_27
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2270_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 48172476 - 48172252
Alignment:
| Q |
16 |
atctagtttcatgggtacacaaactatagcaatctcttttcaatattactttttgtcctatataaaataaaatacaatatgagatgattatggggnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48172476 |
atctagtttcatgggtacacaaactatagcaatctcttttcaacattactttttgtcctatataaaataaaatacaatatgagatgattatggagttttt |
48172377 |
T |
|
| Q |
116 |
nngtgttttaactctccgattccaacggtaagggcccttggtaatctagagttcagtcggaactctggttaattattgattcaaccaggattctaacttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48172376 |
ttgtgttttaactctccgattccaacggtaagggcctttggtaatctagagttcagtcggaactctggttaattattgattcaaccaggattctaacttg |
48172277 |
T |
|
| Q |
216 |
tgattcccgaatgatttgcccttaa |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48172276 |
tgattcccgaatgatttgcccttaa |
48172252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University