View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2270_high_31 (Length: 238)
Name: NF2270_high_31
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2270_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 2 - 231
Target Start/End: Original strand, 38272709 - 38272938
Alignment:
| Q |
2 |
attgtaattctaacaaatatatcaattgtgatatcaaatatgaattgttgacaatgtgatgtttgcgagtaacatgtaatcagctttggaagtgatctgt |
101 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38272709 |
attgtaattctaacaaatctatcaattgtgataccaaatatgaattgttgacaatgtgatgtttgcgagtaacatgtaatcagctttggaaatgatctgt |
38272808 |
T |
|
| Q |
102 |
caaggtttttattagctctttatattcaatcttatctaaggagctaaaattacggtactttattgtaattatagcaaattcattgtgatatcaaacatac |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272809 |
caaggtttttgttagctctttatattcaatcttatctaaggagctaaaattgcggtagtttattgtaattatagcaaattcattgtgatatcaaacatac |
38272908 |
T |
|
| Q |
202 |
accgaatctttgttgacaatatgatgatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38272909 |
accgaatctttgttgacaatatgatgatgt |
38272938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University