View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2270_high_9 (Length: 444)
Name: NF2270_high_9
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2270_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 414; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 1 - 430
Target Start/End: Complemental strand, 45626187 - 45625758
Alignment:
| Q |
1 |
acatgactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttggagtgtcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45626187 |
acatgactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttgcagtgtcttcaa |
45626088 |
T |
|
| Q |
101 |
atttaaaagtgtcgaggagatcagagcaggatgcatcatgttccccttcttcagtcagaagctcaagacccaactcatcttcaatatggtcagaagcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45626087 |
atttaaaagtgtcgaggagatcagagcaggatgcatcatgctccccttcttcagtcagaagctcaagacccaactcatcttcaatatggtcagaagcaga |
45625988 |
T |
|
| Q |
201 |
tatgagcaaaaactcgcatccttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccgggaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625987 |
tatgagcaaaaactcgcatccttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccgggaac |
45625888 |
T |
|
| Q |
301 |
accgccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatccctcacgttcaatgttga |
400 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625887 |
atcgccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatccctcacgttcaatgttga |
45625788 |
T |
|
| Q |
401 |
gtgcttcctggggttcattcttctcatctt |
430 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45625787 |
ttgcttcctggggttcattcttctcatctt |
45625758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University