View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2270_low_27 (Length: 250)

Name: NF2270_low_27
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2270_low_27
NF2270_low_27
[»] chr7 (1 HSPs)
chr7 (16-240)||(48172252-48172476)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 48172476 - 48172252
Alignment:
16 atctagtttcatgggtacacaaactatagcaatctcttttcaatattactttttgtcctatataaaataaaatacaatatgagatgattatggggnnnnn 115  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |         
48172476 atctagtttcatgggtacacaaactatagcaatctcttttcaacattactttttgtcctatataaaataaaatacaatatgagatgattatggagttttt 48172377  T
116 nngtgttttaactctccgattccaacggtaagggcccttggtaatctagagttcagtcggaactctggttaattattgattcaaccaggattctaacttg 215  Q
      |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48172376 ttgtgttttaactctccgattccaacggtaagggcctttggtaatctagagttcagtcggaactctggttaattattgattcaaccaggattctaacttg 48172277  T
216 tgattcccgaatgatttgcccttaa 240  Q
    |||||||||||||||||||||||||    
48172276 tgattcccgaatgatttgcccttaa 48172252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University