View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2270_low_29 (Length: 239)
Name: NF2270_low_29
Description: NF2270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2270_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38272457 - 38272696
Alignment:
| Q |
1 |
agacaggagtgataaaaggagaaaaatgaatgaatatattattgcaccgatggtttttgggacttggccattttatttagtagannnnnnnnn--caaca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38272457 |
agacaggagtgataaaaggagaaaaatgaatgaatatattattgcaccgatggtttttgggacttggccattttatttagtagatttttttttttcaaca |
38272556 |
T |
 |
| Q |
99 |
tgaaaagtttgatctaggtgggacccattgttaattatttaactcaaattcttatatgatttgtgtttgtgtgtgaatgtttgttatcacggtgaatttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272557 |
tgaaaagtttgatctaggtgggacccattgttaattatttaactcaaattcttatatgatttgtgtttgtgtgtgaatgtttgttatcacggtgaatttg |
38272656 |
T |
 |
| Q |
199 |
tctgaattgttgtagctttttataagatcgcgatgatggt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38272657 |
tctgaattgttgtagctttttataagatcacgatgatggt |
38272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University