View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_60 (Length: 304)
Name: NF2272_high_60
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 21459313 - 21459042
Alignment:
| Q |
19 |
ctcttttggtcattgactcataaaatttgtctatggttacgtagtaaactctatgattctgatattattttcagcttacatccatttctcctgaagcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21459313 |
ctcttttggtcattgactcataaaatttgtctatggatacgtagtaaactctatgattctgatattattttcagcttacatccatttctcctgaagtttt |
21459214 |
T |
|
| Q |
119 |
gagtgcagctattgctaatattaaagaggtggttcatttgaatgatgcattaccagaggcaagattgtttaatgaactaccagagatgtcggattaacta |
218 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
21459213 |
gagtgcagctgttgctgatattaaagaggtggttcatttgaaatatgcattaccagaggcaaaattgtttaatgaactaccagaaatgtcggatgaacta |
21459114 |
T |
|
| Q |
219 |
gtact---agactttattattctggaaggtgcggtctctcgccactgaagtgtttaattttcatttcatatt |
287 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21459113 |
gtactaccagactttattattccggaaggtgcggtctctcgccactgaagtgtttaattttcatttcatatt |
21459042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University