View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_62 (Length: 301)
Name: NF2272_high_62
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 31623134 - 31623386
Alignment:
| Q |
17 |
tgtgtgcactctactctatgtgtgtcttgttagaacttgtagttcttctagtgtgactatcagtctgtgccttattatcgaagtgatgcaagaatttgat |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31623134 |
tgtgtgcactctactctatgtgtgtattgttagaacttgtagttcttctagtgtgactatcagtctgtgccttattatcgaagtgatgcaagaatttgat |
31623233 |
T |
 |
| Q |
117 |
tttggacttcagtgttttaaattttcgatttcaagcatataggactttgctatgtggagcctttgttttggcatctaaggaattttatgtgtcttgctct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31623234 |
tttggacttcagtgttttaaattttcgatttcaagcatataggattttgctatgtggagcctttgttttggcatctaaggaattttatttgtcttgctct |
31623333 |
T |
 |
| Q |
217 |
tgcatatcaatgatgccatgatccaaatgttgctcatgctcatgctcatgctc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31623334 |
tgcatatcaatgatgccatgatccaaatgttgtgaatgttcatgctcatgctc |
31623386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University