View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_66 (Length: 292)
Name: NF2272_high_66
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 23 - 132
Target Start/End: Original strand, 12178494 - 12178605
Alignment:
| Q |
23 |
tattcaccagggcttcccacatatcagaaaataaatattccaccatgcacttttatgacaccgtaaattccaaattttagtaaataaaag--aaaacaat |
120 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12178494 |
tattcactagggggtcccacatatcagaaaataaatattccgccatgcacttttatgacaccgtaaattccaaattttagtaaataaaaggaaaaacaat |
12178593 |
T |
 |
| Q |
121 |
agtttataaata |
132 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12178594 |
agtttataaata |
12178605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 133 - 179
Target Start/End: Original strand, 12179019 - 12179065
Alignment:
| Q |
133 |
acgcatcagttcaatggagtaaaaatttgatttctttttcaaataaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12179019 |
acgcatcagttcaatggagtaaaaatttgatttctttcccaaataaa |
12179065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University