View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2272_high_66 (Length: 292)

Name: NF2272_high_66
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2272_high_66
NF2272_high_66
[»] chr1 (2 HSPs)
chr1 (23-132)||(12178494-12178605)
chr1 (133-179)||(12179019-12179065)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 23 - 132
Target Start/End: Original strand, 12178494 - 12178605
Alignment:
23 tattcaccagggcttcccacatatcagaaaataaatattccaccatgcacttttatgacaccgtaaattccaaattttagtaaataaaag--aaaacaat 120  Q
    ||||||| ||||  ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
12178494 tattcactagggggtcccacatatcagaaaataaatattccgccatgcacttttatgacaccgtaaattccaaattttagtaaataaaaggaaaaacaat 12178593  T
121 agtttataaata 132  Q
    ||||||||||||    
12178594 agtttataaata 12178605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 133 - 179
Target Start/End: Original strand, 12179019 - 12179065
Alignment:
133 acgcatcagttcaatggagtaaaaatttgatttctttttcaaataaa 179  Q
    |||||||||||||||||||||||||||||||||||||  ||||||||    
12179019 acgcatcagttcaatggagtaaaaatttgatttctttcccaaataaa 12179065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University