View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_70 (Length: 266)
Name: NF2272_high_70
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 47811165 - 47810906
Alignment:
| Q |
1 |
agtagccatatatattgcagtttgaggaacaatattaatgggatgattgaaggtttagatatttgaatgagcttttataggcaaagatgaagtgtccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47811165 |
agtagccatatatattgcagtttgaggaacaatattaatgggatgattgaaggtttagatatttgaatgagcttttataggcaaagatgaagtgtccttt |
47811066 |
T |
|
| Q |
101 |
cttttgtnnnnnnnnnnnnnngaaatgaagtgtcctttcatggccatgtttgatgtaaatttgcaatttttatatttatatttagggatttgatcaatga |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47811065 |
cttttgtaaaaaataaaaaaagaaatgaagtgtcctttcatggccatgtttgatgtaaatttgcaatttttatatttatatttagggatttgatcaatga |
47810966 |
T |
|
| Q |
201 |
atcctgcataaagcagatcatgaatattgttaattttgtgttgagatcatcttcatttca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47810965 |
atcctgcataaagcagatcatgaatattgttaattttgtgttgagatcatctccatttca |
47810906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 47787803 - 47787751
Alignment:
| Q |
41 |
ggatgattgaaggtttagatatttgaatgagcttttataggcaaagatgaagt |
93 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
47787803 |
ggatgattgaaggtttagacatatgaatgagcttttataggcaaagatgaagt |
47787751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University