View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_76 (Length: 254)
Name: NF2272_high_76
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 161443 - 161681
Alignment:
| Q |
1 |
ccgtaccatggctgcattatggttggtgtattttagagatgcttggagagctagttctactttggttgggattgcttttcttgtttacactgcattcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
161443 |
ccgtaccatggctgcattatggttggtgtattttagagatgcttggagagctagttctactttggttgggattgcttttcttgtttacactgcattcaac |
161542 |
T |
 |
| Q |
101 |
tttgtacgtcttgccaagattctcttctagtagagaaacttgaaaatgtataattcgtggtttggattattatcataactagattga--tgagtgttatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
161543 |
tttgtacgtcttgccaagattctcttctagtagagaaacttgaaaatgtataattcgtggtttggattattatcataactagattgatgtgtgtgttatg |
161642 |
T |
 |
| Q |
199 |
tgtatttatttattttggtctaagtatagttgttaagat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
161643 |
tgtatttatttattttggtctaagtatagttgttaagat |
161681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 152966 - 153159
Alignment:
| Q |
1 |
ccgtaccatggctgcattatggttggtgtattttagagatgcttggagagctagttctactttggttgggattgcttttcttgtttacactgcattcaac |
100 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
152966 |
ccgtaccatgactacattatggttggtgtattttagagatgcttggagagctagttctactttggttgggattgcttttcttgtttacactgcattcaac |
153065 |
T |
 |
| Q |
101 |
tttgtacgtcttgccaagattctcttctagtagagaaacttgaaaatgtataattcgtggtttggattattatcataactagattgatgagtgt |
194 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| ||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
153066 |
tttgtacgtcttgccaagattcttttctactagacaaacttgaaaatgtataattcatggtttgaattattatcataactagatttatgtgtgt |
153159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University