View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_82 (Length: 246)
Name: NF2272_high_82
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 9938749 - 9938983
Alignment:
| Q |
1 |
acatagtataactgtgcactcaatatggtaacaaagttgagtctggatgtcttagttgcttataggcgtgctgaaaatgatgtatgtaactttcttggtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938749 |
acatagtataactgtgcactcaatatggtaacaaagttgagtctggatgccttagttgcttataggcgtgctgaaaatgatgtatgtaactttcttggtc |
9938848 |
T |
|
| Q |
101 |
gaccattgagttgtcctctaaccagtctattcccatgtaatctttattcggaaaatgtaattgaggggaggatatttttgaact-tgtattacaaacaaa |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
9938849 |
gaccattgagttgtcctctaactggtctattcccatgtaatctttattcgaaaaatgtaattgaggggaggatatttttggactgcgtattacaaacaaa |
9938948 |
T |
|
| Q |
200 |
tttgcagctcgaacatatttctttctcccgatatt |
234 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
9938949 |
tttgcagctcaaacatatttctttctcccgatatt |
9938983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University