View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_high_92 (Length: 234)
Name: NF2272_high_92
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_high_92 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 40362975 - 40363170
Alignment:
| Q |
1 |
gtgcgtgagggtttgaacttgccttcaaattggtgccgttgatagttgatgccaaattttgaacttgattctactctaaataaataaattctcatatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40362975 |
gtgcgtgagggtttgaacttgccttcaaattggtgccgttgatagttgatgccaaattttgaacttgattctactcaaaataaataaattctcatatcat |
40363074 |
T |
 |
| Q |
101 |
tcaatttgatctctcaaacggctttgtttggtcctacaactataatggcatcaactaattataagaagtggggaactataaacaaacaatcaagaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40363075 |
tcaatttgatctctcaaacggctttgtttggtcctacaactataatggcatcaactaattataagaagtggggaactataaacaaacaatgaagaa |
40363170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University