View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_104 (Length: 216)
Name: NF2272_low_104
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_104 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 46 - 122
Target Start/End: Complemental strand, 33138908 - 33138832
Alignment:
| Q |
46 |
aataaagaatttagtttagtagatgcccttaagaaagatctacactgaaattttattcctttcatgaatttgtttaa |
122 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
33138908 |
aataaagaatttagattagtacatgcccttaagaaagatctacactgaaattttcttcctttcatcaatttgtttaa |
33138832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University