View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_107 (Length: 210)
Name: NF2272_low_107
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_107 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 75 - 196
Target Start/End: Original strand, 46832836 - 46832957
Alignment:
| Q |
75 |
aaccttactgttgtcttaataaatgttgccaatttagttttagctagtggtatctacctcataggcaattacttttacacatagaaagtcactgaattgg |
174 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46832836 |
aaccttactgttgtcttaataaatgttgtcagtttagttttagctagtagtatctacctcataggcaattacttttacacatagaaagtcactgaattgg |
46832935 |
T |
 |
| Q |
175 |
caaaacaaatggatatagcatg |
196 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46832936 |
caaaacaaatggatatagcatg |
46832957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 46832775 - 46832807
Alignment:
| Q |
17 |
ataggatgcaatgtttactatcgttccaggaat |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46832775 |
ataggatgcaatgtttactatcgttccaggaat |
46832807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University