View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_108 (Length: 201)
Name: NF2272_low_108
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 31045792 - 31045958
Alignment:
| Q |
19 |
cataactcattcagggtccatcattcctgtcatccacaaactctcccaccacatgggtgcctgaatgagtcacatgtcacatgttatgctaaatctaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045792 |
cataactcattcagggtccatcattcctgtcatccacaaactctcccaccacatgggtgcctgaatgagtcacatgtcacatgttatgctaaatctaaat |
31045891 |
T |
 |
| Q |
119 |
gagaatctgagatgatagcaatctttaactcaaaagcctgtctttagaacctatggccacaattcat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045892 |
gagaatctgagatgatagcaatctttaactcaaaagcctgtctttagaacctatggccacaattcat |
31045958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University