View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_37 (Length: 398)
Name: NF2272_low_37
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 26 - 385
Target Start/End: Original strand, 42974229 - 42974588
Alignment:
| Q |
26 |
tacagcacggtggagccggtgacggtgcggttaactgtagagtgcgtaacggacgcatgggtagagggtgagggactagggaatacagatgaagagagaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974229 |
tacagcacggtggagccggtgacggtgcggttaactgtagagtgcgtaacggacgcatgggtagagggtgagggactagggaatacagatgaagagagaa |
42974328 |
T |
|
| Q |
126 |
gtgcaaagctgatggtggacacgtgtccaggatttatatcggacggttacgggagagtgacgtggacaaacggtgcttacagggagatgatgggtgatgg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974329 |
gtgcaaagctgatggtggacacgtgtccagggtttatatcggacggttacgggagagtgacgtggacaaacggtgcttacagggagatgatgggtgatgg |
42974428 |
T |
|
| Q |
226 |
agttatagcgttggtgatgaaaataaatggtgtggttttgtatccgtcgttcacgtgtagggttagggttgtgcagtttgcgtgtggtagggagagaaat |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42974429 |
agttatagcgttggtgatgaaaataaatggtgtggttttgtatccgtcgttcacgtgtagggttagggttgtgcagtttgcgtgtggaagggagagaaat |
42974528 |
T |
|
| Q |
326 |
ttgtttacgttaccttgtgatgtgtggagaatggattgtggtgggtttgcatggagatta |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974529 |
ttgtttacgttaccttgtgatgtgtggagaatggattgtggtgggtttgcatggagatta |
42974588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 34059207 - 34059256
Alignment:
| Q |
142 |
ggacacgtgtccaggatttatatcggacggttacgggagagtgacgtgga |
191 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34059207 |
ggacgcgtgtcctggatttatatcggacggttatgggagagtgacgtgga |
34059256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 385
Target Start/End: Original strand, 34059385 - 34059429
Alignment:
| Q |
341 |
tgtgatgtgtggagaatggattgtggtgggtttgcatggagatta |
385 |
Q |
| |
|
||||||| ||||||| |||| |||||||| ||||||||||||||| |
|
|
| T |
34059385 |
tgtgatgcgtggagattggactgtggtggttttgcatggagatta |
34059429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University