View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_59 (Length: 309)
Name: NF2272_low_59
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 2709533 - 2709441
Alignment:
| Q |
1 |
aaacttcaaaactcttttgttagaagtcggaggtttaggagttgacatgctaaaggatttattagcacctgttaccatataataaggtcgata |
93 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2709533 |
aaacttctaaactcttttgttagaagtcggaggtttaggagttgacatgctaaaggatttattagcacctgataccatataataaggtcgata |
2709441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 165 - 231
Target Start/End: Complemental strand, 2709367 - 2709302
Alignment:
| Q |
165 |
gttggaaaagtgataagatgcttgtattatttgaaactccagcaggttttgcccttttcaaattgtt |
231 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2709367 |
gttggaaaagtgataagatgct-gtattatttgaaactccagcaggttttgcccttttcaaattgtt |
2709302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 234 - 292
Target Start/End: Complemental strand, 2708898 - 2708840
Alignment:
| Q |
234 |
ctgatgcaaaaatggggtgtatcattaaggaaaaactgggaccggtgtgctgcttaagt |
292 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2708898 |
ctgatgcaaaactggggtgtatcattaaggaaaaactgggaccggtgtgctacttaagt |
2708840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 165 - 231
Target Start/End: Original strand, 39833009 - 39833075
Alignment:
| Q |
165 |
gttggaaaagtgataagatgcttgtattatttgaaactccagcaggttttgcccttttcaaattgtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39833009 |
gttggaaaagtgataagatgcttgtattatttgaaacaccagcaggttttgcccttttcaaattgtt |
39833075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University