View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_60 (Length: 307)
Name: NF2272_low_60
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 171 - 291
Target Start/End: Original strand, 16814173 - 16814293
Alignment:
| Q |
171 |
cttatcatgatatgcattttgttaaaaataaaaacgaaaattcagttttcttagtgttactcttttgttttatactttagccagaaacacatttctaatt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16814173 |
cttatcatgatatgcattttgttaaaaataaaaaccaaaattcagttttcttagtgttactcttttgttttatactttagccagaaacacatttctaatt |
16814272 |
T |
 |
| Q |
271 |
tcaatttggccaaatgttgaa |
291 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16814273 |
tcaatttggccaaatgttgaa |
16814293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 16814055 - 16814130
Alignment:
| Q |
10 |
aagaaaatcaaacaaatatactctg--gaatggaatgatgaattaaggggttgttagacaataatcgagtcaccta |
83 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16814055 |
aagaaaatcaaacaaatatactctgtggaatggaatgatgaattaaggggttgttagacaataatcgagtcaccta |
16814130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 230 - 276
Target Start/End: Complemental strand, 17815073 - 17815027
Alignment:
| Q |
230 |
ctcttttgttttatactttagccagaaacacatttctaatttcaatt |
276 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
17815073 |
ctcttttgttttatactttagcaagagacacgattctaatttcaatt |
17815027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University